titolo pulito

Il DNA come antenna biopsichica: un mezzo, non un principio biologico

EDITORIALE – Nuove scoperte scientifiche stanno rivoluzionando il modo di concepire la realtà e noi stessi, ma fino a due secoli fa un medio evo moderno aleggiava sulla nostra civiltà, in cui regnava ancora la concezione Aristotelica.

Un esempio ne é la fisica classica o meccanica classica con le sue rappresentazioni fenomeniche assolutamente misurabili e deterministiche fino all’arrivo di Einstein e della quantistica che hanno sconvolto tutto il panorama scientifico dell’epoca. La medicina, la biologia e la chimica credevano o forse credono ancora che il corpo è solo materia meccanica, manipolabile e regolabile attraverso molecole chimiche fino quando ci fu la scoperta dei biofotoni da parte del Biofisico Prof Fritz Albert Popp, il quale mostra che tutti gli organismi viventi irradiano un debole ma permanente flusso di luce, la cui intensità dipende dai biofotoni presenti in essa.

I biofotoni sono delle particelle di luce, portatrici  d’informazioni che regolano la crescita e la rigenerazione delle cellule e controllano tutti i processi biochimici.

Essi sono ancora oggi, però, un grande mistero per la scienza, scissa tra due teorie piuttosto diverse e complementari: la teoria ondulatoria (con le leggi delle onde) e la teoria corpuscolare (in base alle leggi della fisica delle particelle).

Il primo a teorizzare la presenza di fotoni negli organismi viventi fu il biologo russo Gurwitsch nel 1922, che concluse che dovevano appartenere alla banda di lunghezza d’onda dei raggi ultravioletti.

In Italia il biologo Protti fece studi importanti e originali  soprattutto sul sangue e sui tessuti cancerosi, riscontrando che l’emissione di biofotoni era direttamente proporzionale alla vitalità del soggetto, che in presenza di leucemie il sangue aveva emissioni bassissime di biofotoni e che il potere oncolitico  (cioè di combattere le cellule cancerose) del sangue era proporzionale al numero di fotoni emessi.

L’introduzione nella fisica nucleare di un nuovo rivelatore molto sensibile di luce, il tubo fotomoltiplicatore, permise la prima conferma rigorosa e sperimentale da parte del professor Facchini, fisico, dell’Università di Milano. In questa direzione si inserisce la ricerca originale della tesi di G. Morpurgo, in cui venne studiata l’emissione di alcuni batteri (escherichia coli, stafilococco aureus, pseudomonas aeruginosa e streptococco suis), legando l’emissione al massimo della duplicazione dei batteri, quindi rafforzando la tesi che è il DNA ad emettere Biofotoni.

Questo fu confermato grazie al luminometro, costruito dal dr. Motolese che consentì la verifica sperimentale che anche gli organismi più semplici esistenti, i batteri, emettono biofotoni, e che vi era una stretta relazione fra  duplicazione cellulare ed emissione di biofotoni, confermando un ruolo chiave del DNA in questo fenomeno emissivo.

Ma che cos’è il DNA?

Scoperto nella metà del 900 da Watson e Crick, il DNA è la molecola in cui sono contenute tutte le istruzioni necessarie a una cellula per sopravvivere e svolgere le proprie funzioni; é alla base dell’ereditarietà, ossia della trasmissione delle caratteristiche che rendono un individuo simile ai propri genitori.

Il nome completo del DNA è acido desossiribonucleico (in inglese DeoxyriboNucleic Acid, da cui l’abbreviazione DNA). È costituito da tante unità base che si ripetono, i nucleotidi. Ogni nucleotide contiene una molecola di acido fosforico (gruppo fosfato), uno zucchero (il deossiribosio) e un composto organico chiamato base azotata.

In esso si possono trovare quattro tipi di basi azotate: l’adenina (A), la citosina (C), la guanina (G) e la timina (T). I nucleotidi si legano tra loro a formare un filamento di DNA, in cui si riconosce uno “scheletro” di desossiribosio e fosfato dal quale sporgono le basi azotate. Ciò che lo rende unico è la sequenza dei nucleotidi: i quattro nucleotidi si alternano o si ripetono in ordine non casuale. La sequenza  viene schematizzata usando le iniziali delle basi azotate contenute nei nucleotidi (es. ATGTTTCGGAGCAGCGGGTTA….).

Escludendo il DNA di certi virus è sempre formato da due filamenti appaiati che formano una struttura a doppia elica. Possiamo immaginarlo come una scala a pioli, dove le barre laterali sono costituite dallo scheletro e ogni piolo è costituito da due basi azotate, una per ciascun filamento, legate tra di loro. Per via della loro struttura chimica, le basi azotate si appaiano sempre nello stesso modo: l’adenina con la timina e la citosina con la guanina. Si dice che l’adenina è complementare alla timina, e viceversa, e che la citosina è complementare alla guanina, e viceversa: i due filamenti sono quindi detti complementari.

Dunque alla luce di quanto detto sopra a differenza di quanto si credeva il DNA non è il principio dell’organizzazione cellulare ma il mezzo.

Perché il mezzo ?

Perché grazie alla sua struttura elicoidale ha la capacità di funzionare come antenna biopsichica, permettendo cosi al pensiero inconscio di trasmutare ed organizzare la conformazione molecolare fisica del corpo, lo spiega oggi l’epigenetica ma anche la PNEI(psicologia neuro endocrina immunologica).

Cosa si intende con questo? Si intende che attraverso i pensieri consci o meno modifichiamo la nostra condizione di salute o di malattia. Ad esempio molteplici reazioni emotive negative, come rabbia, gelosia, invidia, forme pensiero a bassa frequenza o abitudini malsane di ogni genere con il passare del tempo vanno a creare squilibri mentali e fisici.

I traumi adolescenziali o infantili che subiamo si ripercuotono poi nella vita dell’adulto come paure, instabilità dell’area affettiva, aggressività, paralisi ecc…

Ulcere gastriche, reflusso o dolori addominali apparentemente non prodotti da nulla, stress, diarrea siano appunto la risposta all’argomento in questione.

Irrigidimento della struttura meccanica del corpo, infiammazioni di diversi generi, tumori e via via discorrendo, con questo non vuol dire che i fautori della malattia sono solo queste avversioni ovviamente ma da tutte quelle condizioni che ne causano la comparsa.

Escludendo malattie genetiche o ereditarie, infezioni batteriche o traumi esterni, significa che il pensiero determina ogni cosa, tuttavia noi non ne siamo consapevoli poiché assopiti da tutte quelle suggestioni che in successione nel tempo ci hanno relegato ad una schiavitù dei vizi.

Perché la percentuale di malattie mentali è aumentata cosi drasticamente nel tempo? Per il fatto che una vita dedita alla mondanità ed alla licenziosità del piacere e del materialismo ha comportato uno squilibrio totale, in cui le persone hanno perso il senso dell’orientamento e della felicità di sé stessi.

Una cattiva educazione, scorretti stili di vita, abitudini sbagliate ed ignoranza hanno portato l’uomo all’inconsapevolezza totale, rendendolo simile all’animale privo di ragione.

Perciò dovremmo sempre interrogarci della ragione della vita, perché esistiamo e qual’è la logica dietro a tutto, non si può vivere passivamente come amebe, risvegliamoci da questo sonno che dura sino alla fondazione.

La conoscenza è vita e comprensione di essa, per vivere in armonia con il tutto in modo giusto e significativo.

“Fatti non foste a viver come bruti, ma per seguir virtute e canoscenza”, Canto XXVI Inferno.

Dante Alighieri.

Certified
Lascia una risposta

L'indirizzo email non verrà pubblicato.

This website uses cookies to improve your experience. We'll assume you're ok with this, but you can opt-out if you wish. Accept Read More

Privacy & Cookies Policy